Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10985G10
Clone ID IST10985G10
Vector VICTR76
Project tigm

Sequence tag IST10985G10HMR1
Sequence
TAGTTTAGTTACTTTGTCTCATTCCTAGGAAGAGTCTAAGCCAAATGCTCAGTCTTATAAGAACAGCGAGCAGTTCCCTA
GGGTTTCTCACATCTCTAGCTGAGTAGCAAGTTACCTTAAGCTCTGCTCTGAGACAGTCACCAGTTTGTTACAGTTTGTT
ACNTCTGTCTGGGCGGAGGTGGTCTGTACTGGTTCCNGN
Sequence Type genomic DNA
Unitrap ID UNI33074

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121381564..121381759 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]


Sequence tag IST10985G10HMF1
Sequence
CTAAGTTTTAAAGAATTAAACATAAAGGTGAAGCCAAGTAAAATCTAAAGTCTTAAATGCGTGCTGGCCCTTGCCANCAN
CTTCAGGTATGACCAANAGCCTANCCAGCTATCACAGTGTCCTTTCCCTGTCCCCAAACTGACATCACATTCCAGCCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121381409..121381566 148
NO GENE  

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es