Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14348C12
Clone ID IST14348C12
Vector VICTR74
Project tigm

Sequence tag IST14348C12HMF1
Sequence
AGTGGGCCNCTGCTGAGTGTCATAGGAGCCAGTCAGCATGACGCTGGGCTCTATTCCCCAGGATGGTGGACTGAGGCGTG
GTGGTGAGAGCTAGACGTTGGTCTCTCCAGAATGTGTGGTGCTGTGGGCTGGTAGGGTGGGGGAGGGGTGACNNGCNCAC
AGGGAAAGACCNNANGCTTCTGGGAGGTGCTGCTGCTGGCCTGAACCTGGAAGTANGAATTTGGCANGTCC
Sequence Type genomic DNA
Unitrap ID UNI9646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168056968..168057197 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]

 
Come back to gene ENSMUSG00000026564


For any suggestions or comments, please send an email to unitrap@crg.es