Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10296D3
Clone ID IST10296D3
Vector VICTR76
Project tigm

Sequence tag IST10296D3HMF1
Sequence
TTATAATTAGCTCCAGTGCTATCCACAACACCCTGGACTCTTCCTCTGTTGGCAGTCAGTCCACATGAGTGCTTTTCTGA
CTCCCCACCCCCACCCCGCCCCCATAGTCTGGCAGAGGCAGGCTTGGGCCATGTAGTGTTAGAAGAGGGAGCAGCCATAT
TTGCTGGCTTAAGATGCAGGAGTAGTCCATGGTGAATGCAGGGGAAGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15158367..15158578 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073455 (9030025P20Rik) NP_001116844 RIKEN cDNA 9030025P20 gene Gene [Source:MGI Symbol;Acc:MGI:3583895]

 
Come back to gene ENSMUSG00000073455


For any suggestions or comments, please send an email to unitrap@crg.es