Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10073D10
Clone ID IST10073D10
Vector VICTR75
Project tigm

Sequence tag IST10073D10BBR1
Sequence
ATCCCGATCTTTTATTTCAGAGGGCTTTTGTTAATTTGTAGTCTTTGAAGTGTACCAGGACTGACCTGGAGTTCTGTGGC
AGGGCTTTAACTCTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32556925..32978036 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es