Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0875
Clone ID XR0875
Vector pGT0lxf
Project sanger

Sequence tag XR0875
Sequence
CTTTTCTCCGGGACGGAAATATTTGTTCTGCCCCCAGGTTAGGGAAGCTCTTTTTTTTTTTTTTTGGACCTCCTCCCGGA
GGACAATGTGCATGGCCCCCGGATTCAAGATGGGCTTTTTTTTTTTTTTTTCGCATTCAGCTTGCAAGCTCCTTTCTGTA
ACTCAGCGGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGAGAAGCGTTAGTCAAGCT
CAGAACTCCAAACATG
Sequence Type mRNA
Unitrap ID UNI2607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177138218..177758086 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074519 (Etohi1) ethanol induced 1 Gene [Source:MGI (curated);Acc:Etohi1-001]

 
Come back to gene ENSMUSG00000074519


For any suggestions or comments, please send an email to unitrap@crg.es