Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13178G5
Clone ID IST13178G5
Vector VICTR74
Project tigm

Sequence tag IST13178G5HMF1
Sequence
GAGGTAGTGTTCTTCAGTCCACCTTTGTGTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI34879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75907330..75907363 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075270 (Pde11a) NM_001081033 phosphodiesterase 11A Gene [Source:MGI (curated);Acc:Pde11a-001]


Sequence tag IST13178G5BBF1
Sequence
CCAATAAGCAAGGTTAGTACATTTANAGACTTTCCCANAACTATGGCGTTTGATGGATTAGGACTTTGTTTTCCTTTGGC
AAGTGGTGCTGTCTACATGCTGAGTTTTATGGCCTGAATGGCGTTTCTACCATGGAGTCTGTCTGGGAGCCTACTACCAG
TCCATGATCAACTTGAAACTTATTTCAATCNCAATATTTAAACTTAAAATATTTTTGCTTTAAATTATGGTATAACCCCA
AAATGTGGTGGTGGGGCTGTGGTAAANATGCTTGCTGCTGANACCNACTAGCTGANTTCANTCCCTGGGACCCATACAGT
ANGAGACANATTCNTGCATGTTGTCCTCCCTTCCACACNNNNNTGTAACCCAGGCAAANNTCANNCNNNNNATATANCCN
ANAATGACCTTTCATTCTTGANTGTCCTGNANNTCTNNNACANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075270


For any suggestions or comments, please send an email to unitrap@crg.es