Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0874
Clone ID XR0874
Vector pGT0lxf
Project sanger

Sequence tag XR0874
Sequence
TTTTTACAATGAACATGAGGAGATAACCAACCTCACTCCACAGCAGTTGATAGACCTGCGACATAAGCTCAACCTTCGGG
TCTCTGGTGCTGCACCTCCCAGACCAGGAAGTAGCTTTGCTCATTTTGGGTTTGATGAACAACTTATGCACCAGATTAGG
AAATCTGAGTACACACAGCCGACCCCAATACAGTGTCAGGGTGTACCTGTAGCACTAAGTGGGAGAGACATGATTGGTAT
TGCTAAAACAGGCAGTGGGAAAACTGCAGCCTTTATTTGGCCCATGTTGATTCATATAATGGATCAGAAGGAATTGGAAC
CAGGTGATGGACCAATTGCAGTTATTGTGTGTCCTACTAGGGAGCTTTGTCAACAGATCCACGCAGAGTGTAAGCGGTTT
GGGAAAGCGTATAATCTTCGATCAGTGGCCGTGTATGGAGGAGGGAGCATGTGGGAGCAGGCCAAGGCCCTTCAGGAAGG
GGCAGAGATTGTTGTATGTACCCCA
Sequence Type mRNA
Unitrap ID UNI2605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106094146..106098437 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es