Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14698E6
Clone ID IST14698E6
Vector VICTR76
Project tigm

Sequence tag IST14698E6HMR1
Sequence
CCNGCAGCCCACAGAGAGTGGCTGCCGAGCCNGAGTCCCCACTGGATGCCTTTTATGTCTACAAAGAGCACCCCTTTATT
GTGACCCTCAAGGAGGACCAGATTGAAACCCTTAAACAGCAGCTAGGAATCTCAGTTCAAGGACAAGACGTTGCCAGGCC
CATTATCGACTTCGAGCACTGTGGCTTCCCTGAGACCTTAAATCANAACTTGAAGAAATCAGGCTACNAAGTGCCNACCC
CCATCCNNATGCANATGATTCCTGTGGGGCTCCTGGGAAGGGACATTCTGGCCANCT
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313612..138313905 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]


Sequence tag IST14698E6HMF1
Sequence
CTGGGTCTTAATGATCCTTCCCCTTCCTTAACTTGTAGCAGATGCTTCGCTTTGCACTCCAAGCTACACACGTCTTCGTC
CGTCTTGTCACAGATATACTCTCCATAACGACCGCAGACGACACATACAGGCTCCCCAGGCTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313470..138313615 146
 
EST/CDNA Est Name
  AA462523.1 - BX511906.1


Sequence tag IST14698E6BBF1
Sequence
CTGGGTCTTAATGATCCTTCCCCTTCCTTAACTTGTAGCAGATGCTTCGCTTTGCACTCCAAGCTACACACGTCTTCGTC
CGTCTTGTCACAGATATACTCTCCATAACGACCGCAGACGACACATACAGGCTCCCCAGGCTCTGGCCACCGCTGGGTTT
TAGAAAACGACTTTACAGGCTCTTCAGATGGGTGGCTGTCCTTCACACCCTCATCAGGTCCTGTGGAAGAAACCTCAGCC
AACTGGCAAGAAGGACTGTTGGTGCTTGATGCATGGCCGGGCTTGTCTGCTGTGACAGCTTCCTCAGTGACTGATGTGTG
GACCGGAGTATCTCTGTCTCCCTCCACCTGAAGGCCTCCTGCTTCTGGCTTGCTTTTTTTAGCTTCACCGCTTTTGAGGT
CATCATTANAACTCCTCTTGATTTTCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313182..138313615 432
 
EST/CDNA Est Name
  AA462523.1 - BX511906.1

 
Come back to gene AA462523.1 - BX511906.1


For any suggestions or comments, please send an email to unitrap@crg.es