Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13059G6
Clone ID IST13059G6
Vector VICTR76
Project tigm

Sequence tag IST13059G6HMR1
Sequence
GTCTTAGTTAGGGTTCCGCTGCTGTGAAGAAACACAGTGACCNCGACAACTCTTTTAAGGACATTTAATTGGGGCTGGTT
TACAGTTTCAAAGGTTTAGTCCATTATCGTCATGGCAGGAAGCATGGCAGCTTGCAGGCAGACATGGTGCTAGAGAACGA
GCTGAGAGTTCTACATCTCTTTGTTTTTGTTTGTTCTTTTGAGACATGTTTTCTCTGTGTAGCCCTGGCTGTCCTGGAAC
TCTGTGGACCATGCTAGCCTAGAACTCACAGAGATCTGCCTGTCTCTGCCTCCTGAATGCTGGGAGGTATACAACCATCT
CCTGACTCGAGTTCTACATCTTGATCCNAAGGCAACAGGAAGGGACAGANACACTTCCTCCAACAAGGCCACACTTCCTA
ACAGTGCTGCTTCCTGTGGGCCTGTGGGGGCCATTTTTATTCNNTCC
Sequence Type genomic DNA
Unitrap ID UNI11791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114391674..114392115 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042364 (Snx18) NM_130796 sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]

 
Come back to gene ENSMUSG00000042364


For any suggestions or comments, please send an email to unitrap@crg.es