Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12068C2
Clone ID IST12068C2
Vector VICTR76
Project tigm

Sequence tag IST12068C2BBF1
Sequence
GTTGGTGATGCAGGATTGGTGCTGCTTCTGGTTTAGGGCCTCTGAGAGGGGGAGTGTAGGATCTCCTGCAGGCGTCACAG
CCTCACAGCGAAAGCTGGGGAAGTGGGAGGATTTCCCAGAAGGCAAGGAGGCAGTGTCCACCATAGCCTCCAAGCGAGGA
TACACTCAGGTAGTTGGGACGTAGGACCTCATCTGCAGGCCCCTGTTGGTGAGAGCTGCCTTTTCCTGCCCCCCCACTCC
CTCGCAGGAGAGGCCAGAACACGTTGTAGTCTTCAGAAATCTGCAGTGGCTTAACTTCACTCANGAAGGAAAGGTTCTGA
ACCNTGGAGGAGCTAGTCNAATATGTATGCCAGGGTAGTCAGGGCTCCAGGAGCAATTTGGCCTCCAAAANGNCTGCCCA
AAGAAACAGAGAGATGGATTGCTGTGCCTCTGAAATGACTGACCTANCCCCACTCAGTCTTTGCATTTGGGGGCNNAACT
GTAGTCTGGGGACTNCNCGGGCTNNTANNCGGTTGTTCTGATGGANANCATTTATNTNNAAGANNANNAGNCN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148228911..148229452 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST12068C2HMF2
Sequence
CCTNNNNGGTTNNNNANGTCNANTTACACAAATATATAGAGTACTTAAAAAACTTTTTTTTAAAGATAGGGTTTCCCCTA
NTANCCTGGAGCTTAACTATGTATACTATGCTGGTCTTACANAGACAATTCTTTTTTTTTTTTTTTTTTTTTTTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98727005..98727141 127
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es