Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13286-NR
Clone ID PST13286-NR
Vector U3NeoSV1
Project escells

Sequence tag PST13286-NR
Sequence
CTTTTAGACATTGCACAGTGACGTGGTAGAACAGCTGGAGAGATTATCGACTATAGACTGAGTTCTGTTGGACCCTGGTA
TTGTCTAGCCTAGGACCACTGGAAAACCAAGGAAGGGGTTGGAAGGCCTTGGCCTTTTCCTTAATTTTCCCCAATTGGCC
CTTCCAATTGGAAGGGGGCCTTTTCCCTTGGAAAACACCCAACAATTTTCTTATAAAAAGGGAACCCATTTTAAAAATTG
GCCGGTTAACTTTCTGGAAATTAAATTGATTTTTGGCTTAGGGAACAACACCCAGGAATCTCTCTGTGCACANATACTCA
CAAGCACATTCTTCNTTTGTGAAACATGGTGGNGTTTCTTCATGAAGGGGAAAAAATATTTATAAAAAAATATTTTCGGT
GGTGGTTGTTGTTGTT
Sequence Type genomic DNA
Unitrap ID UNI15106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150429228..150429321 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029657 (Hsph1) NM_013559 heat shock 105kDa/110kDa protein 1 Gene [Source:MGI (curated);Acc:Hsph1-006]

 
Come back to gene ENSMUSG00000029657


For any suggestions or comments, please send an email to unitrap@crg.es