Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11328E1
Clone ID IST11328E1
Vector VICTR76
Project tigm

Sequence tag IST11328E1BBF1
Sequence
CTGTTGTAAGTTTTTAGGTCCTTCATTGGGTTTTATAACTTAACAAAATCTGTAACAGTCCAGTGTGTGCTTATTTTGTC
TTATTCTCTTTTANGTTATTTTCCTTCACGGATTGGGAGATACAGGGTAGGTGCCATTGTTAGTACCTAAGGAGATGGGG
TCGTGCANCTACTTACTGGTCAAAGGGTTGTATGCTGAANAAGGCTGACATTGTANGAACAAGTATTTTCTCANGGANAT
CANCTTTTCTGCTTACNAACACCCACNATTTCCCCCTTATCTTGAGTTTCTCGTCTTTGNNATTGTCTCTGGAACATGTT
AAAATTGTTAACTGCTCTTTGGATGTGAATTGGATACNNNANGAGTGGAATGTTTGCAAAGGCAGTGTGCAGTTTTGGAG
CNNGTTGAGAAAGANCGGTTGATTCTGTTGAGAGAAATANCNATANCNTGAAGCNTANNTCCCAGNNNANNNTGCANATG
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11328E1HMF1
Sequence
CTGTTGTAAGTTTTTAGGTCCTTCATTGGGTTTTATAACTTAACAAAATCTGTAACAGTCCAGTGTGTGCTTATTTTGTC
TTATTCTCTTTTAGGTTATTTTCCTTCACGGATTGGGAGATACAGGGTANGTGCCATTGTTAGTACCTAAGGAGATGGGG
TCGTGCANCTACTTACTGGTCAAAGGGTTGTATGCTGAANAAGGCTGACATTGTANGAACAAGTATTTTCTCAAGGANAT
CANCTTTTCTGCTTACAAACACCCACAATTTCCCCCTTATCTTGAGTTTCTCGTCTTTGNNNTTGTCTCTGGAACATGTT
AAAATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4798442..4798773 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es