Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15084C11
Clone ID IST15084C11
Vector VICTR80
Project tigm

Sequence tag IST15084C11HMF1
Sequence
GGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCG
ACCGCTGCTGCTGTGGCTTANGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCC
CGGCCCACACAGGGTGCTGCCTCAGCGCCTCTGTGCTTCTGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCT
CACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCTCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAT
Sequence Type genomic DNA
Unitrap ID UNI29704 UNI30806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 23313739..23314050 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 86533549..86533860 310
 
EST/CDNA Est Name
  BU936096.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 99687804..99688115 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363499..22363810 310
 
EST/CDNA Est Name
  BY302409.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14305997..14306308 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142448..25142759 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 21805579..21805890 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84941963..84942274 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692335..11692646 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4023124..4023435 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51188935..51189246 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17245376..17245687 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 29771001..29771312 310
 
EST/CDNA Est Name
  BX514557.1 - AI463819.1 - AA286169.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 25115378..25115689 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 46791556..46791867 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535660..18535971 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 34740446..34740757 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24947426..24947737 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378642..51378953 310
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 24541145..24541456 310
 
EST/CDNA Est Name
  AV205690.1 - CJ195420.1 - BB784772.1 - BY673739.1

 
Come back to gene AV205690.1 - CJ195420.1 - BB784772.1 - BY673739.1


For any suggestions or comments, please send an email to unitrap@crg.es