Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11548D6
Clone ID IST11548D6
Vector VICTR76
Project tigm

Sequence tag IST11548D6HMF2
Sequence
AAAGTATTTTACGTTTGAGTCAATGCAGGGCTCTGGGCNGNCCCNNAGCAGCTTGTGGCCNTTCTTTTGTTTTGCAAACA
GTGCCTGAGAAAGATTTTTCCCTGTGTTCAAGAGAAATTCTTTTTAACAGTGTTGCAGATCTATTCAGATGTTTAAAATA
ATGCTTAAATTCAAAGAGTTTTGCTTCTAGTGAACTGTAATCACTANNNAAATTTTGCCTCTAGGTATGGCTNANGNNNN
NTTACNTTATGTAAGAAAAAATTTTATTGNTTCTGCTTCTATACNNGAAGCCNANAGTTTTAATCTTTCAGTGTNTATTG
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11548D6BBF1
Sequence
AAAGTATTTTACGTTTGAGTCAATGCAGGGCTCTGGGCAGCCCCNNANCANCTTGTGGCCTTTCTTTTGTTTTGCAAACA
GTGCCTGANAAAGATTTTTCCCTGTGTTCAAGAGAAATTCTTTTTAACAGTGTTGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136298535..136298676 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15071412..15071553 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95201837..95201978 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939279..136939420 132
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108035858..108035999 132
NO GENE  


Sequence tag IST11548D6HMR1
Sequence
CNNNTTTNNNTACNCTTTCTTAAGATGACTTACAGTTAAAACGTTCTTCACAACTTTAGTGTTGTGAAAAAATTGCCCGT
ACTGCAGTTTCCTGCCAGGCAGCAACTATAACCAAACTGTTTGC
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI15588 UNI15589 UNI16988 UNI31033 UNI32370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7468359..7468471 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30622263..30622375 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6648574..6648686 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28106981..28107093 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 90427130..90427242 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87788121..87788233 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27207279..27207391 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31381694..31381806 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32508198..32508310 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44896615..44896727 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38947679..38947791 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110305887..110305999 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 57487822..57487934 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074591 (Gm410) NM_001033349 gene model 410, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685256]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939085..136939197 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115775990..115776102 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 66638595..66638707 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41653735..41653847 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779217..84779329 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15920145..15920257 111
NO GENE  

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es