Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13269-NL
Clone ID PST13269-NL
Vector U3NeoSV1
Project escells

Sequence tag PST13269-NL
Sequence
GAGTACAGATTATACAGTCGANANGAGTTGGAGAGGAAAGTCTATACCCNGTATAGAGAGANTAAGAAGTTCNGCGTATA
AANGGGGCACAGGTGAGGTACAGAGGTGTGCTTGGGAGTGGTCTGTGNATCGAGATTCAAGGGGAGGCCTGCGAAGTCAG
ATCTGCCTGCCCCGGCTTCCTGAGTGCTGAGATTAAAGGTGTGTGCCAACCCACCCAACCTTCCAGGTAAAAATGTTAAT
CCTACTCTACCGCTCAGGAAGCAGGGGCAGGCTAGGCTATAGAGCCAGATCCCCTCTAAAAC
Sequence Type genomic DNA
Unitrap ID UNI15088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27769804..28533420 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es