Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10720D12
Clone ID IST10720D12
Vector VICTR76
Project tigm

Sequence tag IST10720D12HMF1
Sequence
AGGTTGTTACATTAGTTATTCTATCGGAGCATACAATACTCGAATAGTTCTCAGGCAAGAGAAATGAGCAGCGAGTCACC
TTCTAACTGCCAGAGCTGTAGCCACAGCGTTCTCGCTTTGTACTTAGCTTGCTAGTCCACTCTTCCCAGGGATCTGGTAA
GTTACAGTCTGGTGGATTACATCAAATTGCTGTAGTAAACGTTTGCTTTAAGTCCCTGAGTGAAGGAAACTCANACAACA
GCTTTGCAATGTGCATAGTGGCAGAAGTTGCCTGGGAAGCTTGGAGCTTGTGTTTTGCANATCCATTGTAATTAAAATAG
AATTGTAAGGGA

Sequence Type genomic DNA
Unitrap ID UNI34884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 129130935..129131265 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030157 (Clec2d) NM_053109 C-type lectin domain family 2, member d Gene [Source:MGI Symbol;Acc:MGI:2135589]

 
Come back to gene ENSMUSG00000030157


For any suggestions or comments, please send an email to unitrap@crg.es