Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14605B4
Clone ID IST14605B4
Vector VICTR74
Project tigm

Sequence tag IST14605B4HMR1
Sequence
NAGGCTTGCCGAGGAGCCGGGGACGTGCAGTTTGGATAACAGGTGATGCCATGGAAAAGCCTATGCAGTGAAAACCCCAC
GCAAGATTTCTGCCACCAGTATAGGACCCGTTGCATGACACTTTGTCGGTTTTAAAGACTTCANATTTAAAAGAAGGGGA
AAAATATCTGTCACTCTGCATTCTGAAGGTCAAATATTCGCCCGCANATGTTTTGGGCTGAACCATTCTTAACTANGTCT
CANGATCTTTATGACAAANACCATTCTGGANCTGTGCATTTGAAATACCCATGGAGGCTTCTTGCANTTGATACTTANTA
TTGTAGATTTAGTTGCTATTCTTGCCAACTGATGTACTTTTAAAACNTGTTCTTTCACNNNTTNATTTATATATCTCTAT
AATGTCCCTTTATCATATTTCN
Sequence Type genomic DNA
Unitrap ID UNI34885

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37086031..37086450 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029190 (D5Ertd579e) NP_001074701 Uncharacterized protein KIAA0232 [Source:UniProtKB/Swiss-Prot;Acc:Q80U59]

 
Come back to gene ENSMUSG00000029190


For any suggestions or comments, please send an email to unitrap@crg.es