Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995H5
Clone ID IST14995H5
Vector VICTR78
Project tigm

Sequence tag IST14995H5HMR1
Sequence
AACAATGTGGGGTTTCTAGGTTTGATGGTGAAAGAGGAACTGACAACCAGGGGCAAACACAGAGAAACAGGGCTCATAGA
GTTAGTTATTCCTGTATCACAACCACTGTGGCAGTCATGATTCTACACACTGGTCCAAACCCACAGATTTCAGCCTGTAA
TATACGTACATTAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 90146098..90146279 182
 
EST/CDNA Est Name
  CA892304.1


Sequence tag IST14995H5HMF1
Sequence
GTTGCTGTTCTTGTACATTCGGCACTTTTGGTTGTTTGAAGATACACTGTGACCTTTATGTCCCAA
Sequence Type genomic DNA
Unitrap ID UNI34886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 90146036..90146100 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037410 (Tbc1d2b) NM_194334 TBC1 domain family, member 2B Gene [Source:MGI (curated);Acc:Tbc1d2b-001]

 
Come back to gene ENSMUSG00000037410


For any suggestions or comments, please send an email to unitrap@crg.es