Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13058D12
Clone ID IST13058D12
Vector VICTR76
Project tigm

Sequence tag IST13058D12HMR1
Sequence
NGCTGGAGAGTTGTACCAAGGTGTCCACACAGTGTACGGTGACACCTAGGTGCTCTGAGCGGTGTGGAGGCTCAAGCAGC
CTGGCCTAGTGGCTGGGAGTCCAGACTCTGGCCTCGCAAGGCTTGTTGTTAAACTTGGAGTTANATGTTTCCTTTCTGAN
CCCAGGCAAGTGTATTGTATATATAACCTGAATCTGTTTCTGCACTGCGCTCAGTCTCTGTCTGTCGGTCTGTCTGTCTA
TCTGTCTGTCTGTCTGTN
Sequence Type genomic DNA
Unitrap ID UNI23952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45602002..45602257 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST13058D12HMF1
Sequence
GCATGTTTGCTCAGGTCANAATGAATGAAATGAACACAACCAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45602256..45602301 44
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es