Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12063D7
Clone ID IST12063D7
Vector VICTR76
Project tigm

Sequence tag IST12063D7HMF1
Sequence
GTNNGGGGCTGATATCTGAGGAAGATAGCTTCCTGACTTGGGGTTCCTCCAACTGCCTTGCAAATCTAANAGTTTGCCAT
TTGATTTTTCAAGTTATTTTCCAGCCTGTTAATTCTGGATATCATTTTTGTTTTCCTTGGTCACATACATGGTGGCTTCT
CCTAACAGTGCAGTGGTTCTCAACCTTCCCTATGCTGCGACCCTTTAATACAGCTCCTTATGTTGTGGTGAGCCCCCCAA
CCATACAATTATTTTCGTGGCTACTTTATAACTGTAATTTTGCTACTGTTATAAATCACAGTGTAAACACCTGTGTTCTT
CTGAANGCCTTANGCAACCCCCGTGAAAGGCGAAAGGGTCCTGACCTGCCAAGGGGTCATGACTCACAGGTTGAGANCCA
CCACTGTAATCGGAGAACAAAAGATCCTTTGTTCACCCTGTTACATTGTTTCACTCTGACAAATATAATTTACAATGAGT
GTTATCTGCAAATAGTCTCCATTTNNNATACCNCTGTGCAGTTGGGTTCTGCTTTCTTTNTAACTNNCCCNGGNTTTTN
Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54045907..54046460 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es