Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0825
Clone ID XR0825
Vector pGT0lxf
Project sanger

Sequence tag XR0825
Sequence
CCAAAGGAAAAGGGAGGGGTGGACCGGATTAGGACCTTTGGTGGTTAAGGCTTCCAGTGGGGACCCAGGGTTAAAAAATT
TAAGGAAGAAGAAAAGGCCAAGAAAGAAGCAGAAAAGAAAGCAAAAGCAGAGGCCAGGCGGAAGGAGCAGGAAGCCAAAG
AAAAGCAAAGACAAGCTGAATTAGAAGCTGTTCGGTTGGCTAAGGAGAAAGAAGAGGAAGAAGTTAGACAGCAAGCATTG
TTGGCCAAGAAGGAAAAAGATACTCCAGAAGAAAGCCATTAAAAGGAAAGGCAGAAACTTCGGAACTGGTGCAAG
Sequence Type mRNA
Unitrap ID UNI2612

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21272374..21274384 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es