Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11830E8
Clone ID IST11830E8
Vector VICTR76
Project tigm

Sequence tag IST11830E8BBF1
Sequence
TTAGGANTNCTGACTGNNNNNNCNNAGGTCCTGAGTTCAATTCCCANCAACCACNGGNNGNCTCACAACCATNTGTAATG
ATGCTCTNTTTTGGTGTGTCTGGANATANTATACTNATATNNATAAAATAAANATANTAAGGTACTTTGAATAGGACTTG
GGAGTATGGTATGGAGGGGANCTGGNGANTGNNAAGCACAGGGCANNCNGNNCCTNTGGGAANCANCCTGCCTTTCCAAA
NTATGCANGTTGGGAGCATGANGAACTACNGNNCCCTNGNNNNCGCCNTGCTGGCTCCCANNGACCTGTCACTNNNATGT
NACACTCATGANTCTGGANAGATGACTNANCANTTATGCNTACTCACTGAACAGANGTCCCACGTTNATCTCCCANCGCT
CACACTGNGCAACTCAACCACTNNNAACTCCNNCCCCAGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11830E8HMF1
Sequence
CAAACACACACACACACACACACACACACACACACACACACACACACGCGCGCGCGCN
Sequence Type genomic DNA
Unitrap ID UNI34888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 170818806..170818862 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56907896..56907952 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9723018..9723074 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 85306793..85306849 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20797938..20797994 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 118117070..118117126 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030110 (Ret) NM_001080780 ret proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:97902]

 
Come back to gene ENSMUSG00000030110


For any suggestions or comments, please send an email to unitrap@crg.es