Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11261C1
Clone ID IST11261C1
Vector VICTR76
Project tigm

Sequence tag IST11261C1HMR1
Sequence
ATAGCTTTTTGGCTCTTAGGCCTTCAGACTCTGACTTTTTAAGTTTTAAGGGAACTGATGGCTCTTATCCCTTTATTCGC
TTTTCTTATTTTGTCAAAAATGAAAAGTAACGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI29634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126499830..126499945 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]

 
Come back to gene ENSMUSG00000027361


For any suggestions or comments, please send an email to unitrap@crg.es