Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12734-NR
Clone ID PST12734-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12734-NR
Sequence
GTAGGGAAGAGAGCTGGCAAACGCCCTGCCTGGGACCTGAAGGGCCAGTTGTGTGACCTCAATGAAGAGTTGAAACGCTA
TCGGGAGAAGACTGAAACGCTGGAACTGGAGAACCGGGGTCTTCGGGAGCAACTCAGAGAGGTCCAGGAGCAGGCCACGA
CCCTGGGGACAGAGCGGAACACCCTGGAAAGGGGAGCTGGCCAGTGT
Sequence Type genomic DNA
Unitrap ID UNI15118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27059870..27060075 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]

 
Come back to gene ENSMUSG00000024301


For any suggestions or comments, please send an email to unitrap@crg.es