Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12597-NL
Clone ID PST12597-NL
Vector U3NeoSV1
Project escells

Sequence tag PST12597-NL
Sequence
TGGGAAAAATTAGGAAATTAAATGGGGGGCCCAAAAGGAAGGGGGGGAAGGGGGGGGCCCCCTTTAAAAGGGGGGAAATT
TTCCCCCTTGGGGGAAAAATTTTGGGGGGGTTAAGGGTTGTAAAAAAAAAACCCAATAAAAAGGGGTTCCTAAGGGTTCC
TTTTGGGGGGGTCCTTAAGGNCCTTTTAGGTCCCCTTTTCCAAGGGGGAGGAAGGGGGGAGGTTTGGGGGGAGGTGGGGG
GTAACCAAAAAAGAAGGCCCCCAAACCCCTTAAAGGGGTTGTGCCTGGTGGCTTTTTCGGGGAAACCTTGGGGGGGGCCT
GTTAGGGGCCCCTGGGTTGGGGAAGGCCCAAGGTTGGGGATGTTAAGTGGGAACCAATGGCTGAATGGTAACTTCAGACT
GGTCCAACTATGTGCCCAGCCGAGAAGGGTCCTATAGCATTGTTCTGTGCTGTATGGTGAAGGAAGAAGTGCCAC
Sequence Type genomic DNA
Unitrap ID UNI15119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71479506..72435721 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031196 (F8) NM_007977 coagulation factor VIII Gene [Source:MGI (curated);Acc:F8-001]

 
Come back to gene ENSMUSG00000031196


For any suggestions or comments, please send an email to unitrap@crg.es