Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0804
Clone ID XR0804
Vector pGT0lxf
Project sanger

Sequence tag XR0804
Sequence
AGACAAGGGAAAAACCCACCCCCCCTGCCATCTATATGTCTATCCTCTGGCCGAGACTTTCCTTCGACTCTTAGGGTGCA
TTAACATCGCGCGTCCAGATATTCTCAATTCCCGATTTTGCGTCATTATCTTTGGGTTCCTTATTGCGCCAATCTAGCCA
TTCCCGGAATATGTGTTCTCTCCCCACCCTTCTCTCTTGAGCCTTATTCTCCGGCCTCGGCCCACCTTCTTAACCCTCCA
CTTCTCCCTCACCCCCATGTAGGGAGAGACCTTCTTAACATGTATATTGAGACAGAGGGCAAGATGATCATGCAAGACAA
GCTGGAGAAGGAGCGGAACGACGCCAAGAACGCCGTGGAGGAGTGTGTATATGAGTTCAGGGACAAGCTATGTGGACCAT
ATGAGAAATTCATATGTGAGCAG
Sequence Type mRNA
Unitrap ID UNI2614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150422452..150423158 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029657 (Hsph1) NM_013559 heat shock 105kDa/110kDa protein 1 Gene [Source:MGI (curated);Acc:Hsph1-006]

 
Come back to gene ENSMUSG00000029657


For any suggestions or comments, please send an email to unitrap@crg.es