Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15066C3
Clone ID IST15066C3
Vector VICTR80
Project tigm

Sequence tag IST15066C3HMR1
Sequence
NCANGGCCNAACTGGGCCTCGCGCCTTCTGCGCTGCCCGCCGGCAGGGTCATCAAACCGCAGGTCATCAACCAGGCTGTG
GGGCTGCCTGCCAGCGGCTCTCTCTACTACTTCAACTACCTGGACTCCACCGCTTACCCACCTTCGGAGCTCCTCGGAGG
CCACCTTTTCCCATCCGGCCTCCTCAACGCACAGGCCCCCACTTCCCTGGCTGCTCACCCCAAGCTTTTTCTGCTGGAGA
ACGCCAAAC
Sequence Type genomic DNA
Unitrap ID UNI34893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 13177063..13177310 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021743 (Fezf2) NM_080433 Fez family zinc finger 2 Gene [Source:MGI Symbol;Acc:MGI:1859823]


Sequence tag IST15066C3BBF1
Sequence
GTTTGATTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAA
CTCAAAGAAATCCATTGTCTCTACCTCTCAAGTGGTGGAATTTGGTTTAGTTTAGTTTAGTTTAGTTTAGTTTAGTTTAG
TTTAGTTTAGTTTTGAGACAGGGGTCCCCTGAATAGCCCTGGATCTCCTGGAACTCACTCTGTAGACCAGGCTGATTTCA
AATGCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021743


For any suggestions or comments, please send an email to unitrap@crg.es