Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14403A11
Clone ID IST14403A11
Vector VICTR74
Project tigm

Sequence tag IST14403A11HMF1
Sequence
TTGCCTTTTGAGGTCAGAAGAAGGCATTTGACCCCCTGGTGTTATGAACCACCACCATGTGGGTGCTGGGAACTAAACCT
AGGTCTTGTGCAGGAGCAACAAGTGTTCTTAACCACTGAGCCAGCCCCTAGACCTACTTTCTTGTCATAAAAGGTAGTCC
ACATATTCCAACTCCCATTCCCTACCTCACTGAGTTACTTTACTTCATTAAAACTCCATAGAGAATCTAGAGATGGCTTA
GCAACTCGGAGTACTTACTGCTCTTGCAGTTTTGTGTCCCANCACCCACACAGTANCNNACNNCTCACAGAGTTCCAGGG
GANNNNNCATCCTGTTCTGGCCTCCATGGNNNCCAAGCAAGCNNNNGGTGAACATACATGTAAGCCTANCATTNNNACNN
NNNNNATANANACNAGTACNTGTAAACAACNNANNNCTNNCAAAANANNTCAGCAGANAANANGCTTGTCGTGAAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14403A11HMR1
Sequence
GCACCACCAAGTTGCATGTGGTACATAANCCNGCTTACCTCCCGGTGGTGGGTNNNNGNNAAATCTAAAAATAAATAAAA
GAATGTAGGTCTNAAATTGATTAANGGCAAGTATATAAACACAATCGTTTGGAAATAAATACTGGGATAGGTTGGTGAAT
CTCTCNNTNTCTCTCAATATGTGTGTGTNTGTGTANNAANANNANTGATGCN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108500502..108500713 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es