Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13638C6
Clone ID IST13638C6
Vector VICTR74
Project tigm

Sequence tag IST13638C6HMR1
Sequence
CTTCTTGTCCTCCCTCCCCACTGTCTCCCCACTTCACTCCTAATGGGTTAGTCAGATTTTCTGTCATAACAGGATATGTG
AGAAAAGCGGTTTAAGGAGAAAGAGACTACAGCATGCTANNCACTAAAGGAAATATATATGACCTCCCTACATCCGCCCC
AGGTTAAGGGATCACTTGGAAGAGAGGGGCGGGAAGAGAGTTAAGAGCCAGAAGGTATGACTGACCGACCACAAGGAAAC
ATCTGGACACAGCAGGGCAGCTGTTCGTAGGAACTTACAACCTTTGCGGCAGTGTACACGAGACCTGTGCAAGCTGAGAG
CAGACTGAGTCCCAGCAAGGCAGGCACACAGTCTCATCTCTGTTCCTTTTGTCGCAGTTCCATTACCTTGACAAAGAGTG
AGTCTAGCATCAAGGCTTCTTTGATTCCNCACTGTGTTTTCTGTTATAGTTGGTCTGCATGCTTCNAAATGTTTCTGGTT
CCTGAAACTCANCTGTNCCTGNNNATCCTTGGTTGGATTTTN
Sequence Type genomic DNA
Unitrap ID UNI11610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73579795..73580314 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST13638C6BBF1
Sequence
NNNNNAGGGCNGANCNGGGCAGATCTATCNAGGTCNATCNACGGTNTCNATTANTCCAATTTANGANTGCCTGAGTGTAT
AAACACCATGTGCGTGCCTGGTGCCCACAGAGGCCAGAAAGATTTCAAATCCCCCTGGGGCTAAAGTTGATGGCAGTTGT
GAGCTGCCACATGGGTGCTGANAACTGAACCAGGTCCTCTGGGANAGGTGCAAGTGCTCTTAACTGCTGAGCCNTCTCTC
CNNCCNATATCATTATTTAAGGGTGGGGTGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73580378..73580585 192
NO GENE  

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es