Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13962H6
Clone ID IST13962H6
Vector VICTR74
Project tigm

Sequence tag IST13962H6HMF1
Sequence
GGTGTACATGGAGAAAGGATTAGGGAAACATTTTTTTGGTAGCTTAAAAACTACTCAATATCTAGCTAATTAATCTGCTA
ACATTGGTCTAATCTAATCTATATTTTATTTGTGTATTGGGAGGAAGCTCTCATATTTCTCCAATTTAAATGACATCACA
TTTGAAAAGGTAAATTTGGAGAATCGAGCTAAGATTANAGGAATCCTCAATCTAAACTGGGCACCACACTCTCAATGCTG
TTC
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17985197..17985438 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST13962H6BBF1
Sequence
GGTGTACATGGAGAAAGGATTAGGGAAACATTTTTTTGGTAGCTTAAAAACTACTCAATATCTAGCTAATTAATCTGCTA
ACATTGGTCTAATCTAATCTATATTTTATTTGTGTATTGGGAGGAAGCTCTCATATTTCTCCAATTTAAATGACATCACA
TTTGAAAAGGTAAATTTGGAGAATCGAGCTAAGATTAGAGGAATCCTCAATCTAAACTGGGCACCACACTCTCAATGCTG
TTAACCTTTGGTGACAGGCTAGAACGTGGGTTCCTTCCTCCTTTANCTGCATTTTTCCNNATCANACTATTACGTTGCTA
ACGCGACCAACCACTTGTATACCTACCAAGCTATAATGCAGTCTTGGGGCTCCCGCTCAGAATATAGCCCAAACACAGGC
TTTTTGCCTGTCTGTGATGCACTTTCATTTGCCACGGGGGCCAAGAANGTGCGTAANTGGGCGGTANATCN
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17985197..17985666 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es