Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12495-NR
Clone ID PST12495-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12495-NR
Sequence
GCCCTGGCTGTACTCTGGAACTCACTTTGTGGACCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAG
TGCTGGGATTAAAGGCGTGCGCCACCACTGCCCGGCTCTGTATATTTTTCATACAGTATATTTTTTCTTTCTTAATGCTT
TTCAGATCCTTTCCACTTTTCTAACTTATATTTTTCTTGCTTTTTAAAACAAACAAAACCAAACAAGAAACAAAACACTT
TCACAAAAACACAAATTAGCAAAGCAAAAGACTGTTA
Sequence Type genomic DNA
Unitrap ID UNI5118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20040822..20041097 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es