Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193D8
Clone ID IST14193D8
Vector VICTR74
Project tigm

Sequence tag IST14193D8BBF1
Sequence
ACGAAAAACACACTATCTCCCTTCACGTTCAAGAGACCGTCCACACAACTTGCACTGAGTCAACCTTTCAGTTACTCCAG
GATTGTTCTACCCAATGTGTCTTCCCACTACCAACCAAATTAACTGCTTTTAAATCCTGCCCCGAGAAAAGGTCAGATCA
GCAACAGCACCTACCCACGATGGACCCCAAAAATTCCCAACAAGATTCTAACCCAAAACGCACACAAACGCACGGAAACA
TTTGAAAACCAAGGTGGAAAGACGAAGACNACCGGAAATGTACCCTAAGAGTCCCAACTACNAAACAAAGTACTACCTAA
AACCACTTCGTCCAAGTAGAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700587..151700933 343
 
EST/CDNA Est Name
  CV677563.1 - BE992823.1


Sequence tag IST14193D8HMR1
Sequence
TCGTGAACTGCAAAACTTGAGTAGCACAAATCCAGGTGAGTTGTTTNAGGGGTCTGTANAGAGAGGATGTTAATTTTTGT
AAAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI12966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700930..151701016 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]


Sequence tag IST14193D8HMF1
Sequence
ACGAAAAACACACTATCTCCCTTCACGTTCAAGAGACCGTCCACACAACTTGCACTGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700873..151700933 61
NO GENE  

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es