Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12460-NR
Clone ID PST12460-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12460-NR
Sequence
ATTTGACTGTGAAGTGGTTTTAATATATTGTTAGGCTTTATTTCTTTTTCTTTTGTAGAAGCAGTGGTAACAGTTTAAAT
ATTTTAAAAAAAACCGATTTTTTTTTTTTTAACCTCTTTTATTTTTTTAAATATTTTTAAGTGTGTTTTAATTTCTTGGG
AGAAAAAAAACACCTATTGGGAATATATTAAGGGTGATATTGGGTCTTTATATATTTCTAATATATATAAAAACATCTCT
TGTGTGTGTTGTTATTGTTGTTATGTGTGGGGGTGTGTGTGTATCTTCCCCCCACATTTTCTCTTTATCCTCTGAGAGTA
TATGTGTTTCTTTTTGTGTGTTGTGTTGTGTTATGTTGTGTTG
Sequence Type genomic DNA
Unitrap ID UNI15127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89836005..89836119 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es