Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0772
Clone ID XR0772
Vector pGT0lxf
Project sanger

Sequence tag XR0772
Sequence
TCTCGTCGCCACGTTGTATTTTGTAGGTTTGACCTCGGACCTGTCCTATCTTTCTTTTGCCCGTTCCTGTACCCTGGATG
TTTCTGTCTATCCCTATCTTATTATTTATCTGTTCTCTACCCCTGCATCCTGTGTGGGCGCGTGAGCGACGGCAGCAGGG
TGTCGGTGTTCCACGTGAAGCTCACCGACAGTGCTTTGAAGGCTTTTGAGAGCTACCGGGCCCACCAGGATTCTGTGTCA
CTGAGACCTTCCATCCGATTTGAAGGAAGCCAAGGA
Sequence Type mRNA
Unitrap ID UNI2615

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73063644..73096808 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es