Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12206C12
Clone ID IST12206C12
Vector VICTR76
Project tigm

Sequence tag IST12206C12HMR1
Sequence
NATCTCATTACAGATGGTTGTGAGCCACCATATGGTTGCTGGGATTTGAACTTCGGACCTTCGGAAGAGCAGTCGGGTGC
TCTTACCCACTGAGCCATCTCACCAGCCT
Sequence Type genomic DNA
Unitrap ID UNI7379 UNI12669 UNI30554 UNI32100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 152986..153092 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10876755..10876861 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024670 (Cd6) NM_009852 CD6 antigen Gene [Source:MGI Symbol;Acc:MGI:103566]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 42600204..42600310 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71159758..71159864 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 82809902..82810008 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79766785..79766891 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49541134..49541240 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021385 (Ippk) NM_199056 inositol 1,3,4,5,6-pentakisphosphate 2-kinase Gene [Source:MGI Symbol;Acc:MGI:1922928]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74257907..74258013 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021103 (Mnat1) NP_032638 menage a trois 1 Gene [Source:MGI Symbol;Acc:MGI:106207]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19951761..19951867 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114900687..114900793 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 114722849..114722955 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 95627328..95627434 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108121376..108121482 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 63514958..63515064 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121984953..121985059 105
 
EST/CDNA Est Name
  AA062263.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5925050..5925156 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 37367760..37367866 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 92798365..92798471 105
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121418740..121418846 105
NO GENE  

 
Come back to gene AA062263.1


For any suggestions or comments, please send an email to unitrap@crg.es