Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162D11
Clone ID IST14162D11
Vector VICTR74
Project tigm

Sequence tag IST14162D11HMF1
Sequence
CTAAGACCTTCATCTTACANNGAAGCAGTNNNGTCTTCCTCAGGAGAAACAGNNNGNCCTACCAACAGCAGTGAGCCTAG
TCACTCTANNNNNNNAAAACCGCTCACTGAACAACTTCACTGAGACTAAAATTAATCTCAAAGGGTTTTTTTAAAAAAAA
AAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14162D11HMR1
Sequence
TTAGCATCTTTATTTTGTGGGTGTCGGTTTCTGCCTTAAAGAGTCCTTTATAAATTGTCACCCAAACTTTATTTTGAAAT
ATAAAGGGCGTTTAAAGTATTTAAAATAATGTTTGAGAAAAGGGAATGGTGTGGCCTATGAAAAGAGAANAAGGATATAA
AAAGACAGCTCANATATTTGGATTTTACCAGAGATCCTGGACCCAAAACTGGCACANTTTTCCTGCAGTGTCCTTGTTAC
GGTGAGGCCANACTCCTTTCTGTGANACACCCAAAAACTTACAGCCGCCTGTTCCCGTTGAGCANCACTAACCTGGAACT
CGGANTCAATGGATTTTGGAAAAAATAAAAGAGAATAAAATAGGTATTTANAGAGACCGATCTGGNCN
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72661597..72661981 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es