Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14472H9
Clone ID IST14472H9
Vector VICTR74
Project tigm

Sequence tag IST14472H9BBF1
Sequence
CCAGAAATCCAAGAGGCAACCAACACAGAAGGCCATAGGGCCAAGCGGTTCTAATGGCTAAGAATTACCAAATGGCCAGT
TGACTAGCAACTGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155076499..155076597 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST14472H9HMR1
Sequence
CTCTTGCAGGTGGTGGCGGGAATCGCAAAGGCAAGAGCAAGAAATGGCGCCAGATGCTGCAGTTCCCCCATATCAGCCAG
TGTGAGGAGCTTCNACTCANCCTTGGTGAGGCCTGGCTCCCAGAGCAGACTGGGGGGAGGGGAGCTGGGGGGGGTANCCA
TGANGANTCATCCCCANACATANCCTTN
Sequence Type genomic DNA
Unitrap ID UNI24726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55550660..55550846 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074886 (Grk6) NM_011938 G protein-coupled receptor kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1347078]

 
Come back to gene ENSMUSG00000074886


For any suggestions or comments, please send an email to unitrap@crg.es