Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10871D12
Clone ID IST10871D12
Vector VICTR76
Project tigm

Sequence tag IST10871D12HMF1
Sequence
CACTGATTTAGAAAAATAGAGGTGCACAGTGCTCTGGAA

Sequence Type genomic DNA
Unitrap ID UNI31864 UNI31865 UNI34902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46250455..46250491 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 27183944..27183980 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55869486..55869522 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21904564..21904600 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 20704994..20705030 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5448728..5448764 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22454369..22454405 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125688901..125688937 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 49450193..49450229 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30400467..30400503 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24736802..24736838 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038072 (Galnt11) NM_144908 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 Gene [Source:MGI (curated);Acc:Galnt11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 121618744..121618780 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66900286..66900322 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034544 (Rsrc1) NM_025822 arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15051415..15051451 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 146229468..146229504 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133539430..133539466 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004552 (Ctse) NM_007799 cathepsin E Gene [Source:MGI (curated);Acc:Ctse-001]

 
Come back to gene ENSMUSG00000004552


For any suggestions or comments, please send an email to unitrap@crg.es