Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0746
Clone ID XR0746
Vector pGT0lxf
Project sanger

Sequence tag XR0746
Sequence
GCCGTCACACGCCCTAACAACCTTGTGCACTTCGCCGAGTCAAAGCTGCCCCAGATGGAAACAGAAGGAGCAGATGAGGG
GAAAGAGCCGCAGAAGCAGGAAGGAGACGGCTGTAGTTTCATCACTCAGCTTGTAAACCACTTCTGGAAACTCCATGCAT
CTAAGCCCAAGAATGCCTTCCTGGCACCTGCCTGCCTGCCAGGCCTTACTCATATTGAAGCTACGGTTAATGCGTTGGTA
GACATTATCCACGGTTATTGTACCTGCGAGCTGGACTGTATCAACACAGCATCCAAGATCTACATGCAGATGCTGCTGTG
TCCTGACCCTGCTGTGAGCTTCTCCTGTAAACAAGCTCTGATTCGAGTCCTAAGGCCCAGGAACAAGCGGAGACACGTGA
CGTTGCCCTCCTCCCCTCGAAGCAACACTCCAATGG
Sequence Type mRNA
Unitrap ID UNI2616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138991036..138994076 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es