Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506H12
Clone ID IST14506H12
Vector VICTR74
Project tigm

Sequence tag IST14506H12BBF1
Sequence
TAGGATTAAAAGCTATCCATCACCACACCCAGTCTTTTGTCTGTTTTTTTANAGACAGAATCTTGCNNTGTGGCTCTGTC
TGGCTTCTCCATCCTCCTGCTTCGATCTCTAGGGTGCTGCGATTACTCCGCTGTGTGCTACACCTGGCTATGATATTTAT
TTCTTCATTCGTTCGCTTGTTTATTGGCACAAGCGTGCCCCACCCCATGCNANNNTGGGTGCCTACAAN
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113280012..113280239 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es