Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12397-NR
Clone ID PST12397-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12397-NR
Sequence
CTCTGTTCCTAGGATTGCAACAGCACCTTGGTGGGCAGGACTCTAATGAAGCCACCAACCCTCTTACTATTTTACAGCTA
AGGCCACCTTTGATGCCATCTCCAAGACTTACAGCTACCTGACCCCCGACCTCTGGAAAGAGACTGTCTTCACCAAGTCT
CCTTATCAGGTATTCGGATTCGGTTGGTGTGTTTGCCTTTATCTTATCTGAGTTTGGGGCATGC
Sequence Type genomic DNA
Unitrap ID UNI15131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24858491..24858714 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044533 (Rps2) NM_008503 ribosomal protein S2 Gene [Source:MGI Symbol;Acc:MGI:105110]

 
Come back to gene ENSMUSG00000044533


For any suggestions or comments, please send an email to unitrap@crg.es