Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15053G7
Clone ID IST15053G7
Vector VICTR80
Project tigm

Sequence tag IST15053G7HMR1
Sequence
TCTGATTTGTACNTCNGANNNNTTGGCAGANAACTTGANATATATAAGATAGTGTTGTACTTTAATTGTCATTACTATTG
GCAACATTGCTATGATGCTCCCCTCCCCCAGCCCCCAATCAGGTTTGGCAGCTGGCTTTGAAGTGCCGCCCTTGTGCCAA
TTTTCCTTAGGACAGAAGATGCTGGGCTGAAGTTAAAGTTCATAGAGCAGCTGCACCTTAAGACTCCCAGTTTGGGACTG
AGGAAATGGCTTTGCTGTANAAGCACTTGCTGTGCAAACAGGGGGACCCTAGTTTGATCTCCTGCATCCATGTAAAACAC
CTGAGCACAGTGGTATAACTTTGTAATCCTAGTCCTGGGGAGATGGAGACAGAGGGCTCCCTGAGGCTCATTGTCCNTCC
AGCCTAANCCNNNCNNTGAGTCCCATGCNNNNNNAGGGACCTGCTCTCAAAAACAAGGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15053G7HMF1
Sequence
CGTCCTACCGGACCCTGGCACGAGAGGGTCCCTCCTCCCCTAGCCACATCTGGTTCTTGTTAGGGTCTCCCAGGATGCCT
GGGCCTGAAGGCCCCATCCCCCGGGGGAGGTGGACAGCAGGATTAGGGGCGATTAGGAGTGCTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10305741..10305888 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


Sequence tag IST15053G7BBF1
Sequence
GAACCTTGGAACTAGAAACAGCAGGAGTGGGCCACAAACTTTCTGGTTCATACCTGAATCAACAAAATTGTACCCACTTA
TGAAAACATACCTGTAATTATTCCTTTCATTAGTATAACTTCAAAAGTTCAAGTAGCCAAAGAACCCCAAACACCATCCC
AAATGAAAAAGCTATTCTGTTCTCTTTGGCTACTCTAAGGGACTCCACTCAATGTTAACTTTTCATTGCTAGACTATTTA
AAGTTCAACTCACAGTTTCAAAATCTTCATAAAAAGGAGACTGATGTCCTGAGTTCAGAAGCAGAGATGGTAAAAATTTA
GCTTTCTTTAGAGAAGCTGATAGAGTCATGTGACCNAGAAACAAAATCAACAATTCNATTACAGATATTTATATTCTTTA
TCCAGGTCTCTGCTATCACAGCTACAAGGTGTGATGCTGTGAACCTTGCAAGANTCATCTCAAGGTATAGTCCTGTGGCT
TGNTGTANAAAGCTGGGAGGCTAGANACNACCNTACNGNATGATGGCTCTAGCAATATGTGCTTANCATCNAGCCTTTNG
CANTTNANTTCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63453140..63453713 542
 
EST/CDNA Est Name
  CX768192.1 - CA553187.1 - CF949820.1 - CA550670.1 - BQ559931.1 - CN723140.1 - CF748566.1 - BU707209.1 - AI931482.1 - BI696555.1 - CD351140.1 - BB628006.1 - CA750725.1

 
Come back to gene CX768192.1 - CA553187.1 - CF949820.1 - CA550670.1 - BQ559931.1 - CN723140.1 - CF748566.1 - BU707209.1 - AI931482.1 - BI696555.1 - CD351140.1 - BB628006.1 - CA750725.1


For any suggestions or comments, please send an email to unitrap@crg.es