Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14259H5
Clone ID IST14259H5
Vector VICTR74
Project tigm

Sequence tag IST14259H5HMF1
Sequence
GTCTGCACTTCCCTACAACAGGGGCTGGAAGTTTGCTACTTTGGTACCTGCAGTCCCTTAGTANAGAGTGACTTGCCACG
AGCCATGAGATCATGCTGACCAAGCACATGCTTCTCAGGGGGAGCTCACGCTCANCTCTATTGCTGAGGTCATTGGCCCC
GTCTGGTCCACCTCCCACTGAGAACTGGGCTAATAGTCGGCACTGAAAGGTTTCCAACCAAACCTTATTTTCTTGTCCTG
TCCAAAATTCATTCCACTCACTACTGCCCTTTCCAGCTCCTGTCTACCTACACACCACTAGGATAACAGTGGAAAGANTC
ATTAGGAAAGAATAAGCACGTGACCCAAGGCCTCACACAAACTGCATTGTTANTTCANCCNGAACCAAGAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84848129..84848523 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14259H5HMR1
Sequence
TCTGTGCCAGGGCCTGCTGGTCACTGGAGGTATTGAGACCCAGGCACACGGCTGAGACAGATAGGCCCGTATGGTATAGT
GTTAGTTTTATGTGAGGAGATCTGCCACTTTTCTCTCCATGGCTACCAGTCCCCAGTCTCATCTCTCCTCACAGGTCTGT
GATCTCCTTGCTCCCATTTTGTTTTCCTGCTTTTTGAGCCTCANCTGGTCTTGAATTCCATCTTCCTTTANCCTCCACAG
CACTGTTTATAGGCACATGTTGCTACNGTTGGCNNGC
Sequence Type genomic DNA
Unitrap ID UNI15630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154898032..154898304 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027597 (Ahcy) NM_016661 S-adenosylhomocysteine hydrolase Gene [Source:MGI (curated);Acc:Ahcy-001]

 
Come back to gene ENSMUSG00000027597


For any suggestions or comments, please send an email to unitrap@crg.es