Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12763-NL
Clone ID PST12763-NL
Vector U3NeoSV1
Project escells

Sequence tag PST12763-NL
Sequence
GCATGCGAGCAGCGCTGAGCCTCCTCGCAGCTAGGAAGCCGATATCCACACCAAGACCAGACTCCCAGGGATGCGGCTGG
GGAACCGTCCCCTCCCGGAGCTTTCCTGAGCACAGGCATCGAA
Sequence Type genomic DNA
Unitrap ID UNI13334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67599262..67599382 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019947 (Arid5b) NM_023598 AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

 
Come back to gene ENSMUSG00000019947


For any suggestions or comments, please send an email to unitrap@crg.es