Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14240H7
Clone ID IST14240H7
Vector VICTR74
Project tigm

Sequence tag IST14240H7HMF1
Sequence
CGGTGACCCTGTAGGGATGGTACTAGGACGCACTCCAGGACACTAGGCTCCTAACATGAGGCCGCAGCCCTCCATAGATT
GGTGTCCTTCAGTCACATAAGGGCAATGCCCCAAGCCCCTCCACAGGTAGAANATGTGACTGACTTGTGGTCNCACAGCC
TCAAGACAGATCTCCNNTTTANTGAGGTACCTAAAGGCCTGGANCCAATANNCTCCCCTTCCNNNANNNTCNNCCCTGCN
NNNNGTATTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14240H7HMR1
Sequence
ACCGGGATTTCAAGCCTGTGCTCGACCNGGAACCAGGCTGCCTTTCACGGACCAACAACATCCTGGCACTTGGGAGGTAG
AGGCAAGAGGGCCAGAAGTTCAAGGTTACTTAGGGGTTTGAGACCAGCTTGAGCTACACGAGAAACTGTCAAAAACTAAC
ACAAAGGAGTGTTTTGCCTTCACTCAAACTTCCTTGACCTGGGTAGGACTCANCATCTGTGTTTTATAAGCCTCCTAGGG
TGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNTNTNTNTGN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121246460..121246742 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14240H7BBF1
Sequence
CGGTGACCCTGTAGGGATGGTACTAGGACGCACTCCAGGACACTAGGCTCCTAACATGAGGCCGCAGCCCTCCATAGATT
GGTGTCCTTCAGTCACATAAGGGCAATGCCCCAAGCCCCTCCACAGGTAGAAGATGTGACTGACTTGTGGTCACACAGCC
TCAAGACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121246291..121246463 173
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es