Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14445G11
Clone ID IST14445G11
Vector VICTR74
Project tigm

Sequence tag IST14445G11HMF1
Sequence
CCTTCCCACTGCACATTGCACAGTGGAGTGGTCCCCACCCCTTCAAGACGCCAGTGGTATGGCCCTCCCAGANCCCAGAG
CGCTCGCACCCCACCACCCCCACGTCCGCGTGCGCGCAGCTTCTCCTAGTCCCTTCCCGACCGGGAGGTAATAAAATAGT
TGGATCCAGTTCTGACTTGCTAGGTGCTCTAGGCGGGGTGAGGTTTCCCAGTCCACCCTGGAAGGGAGGGGTGGCNTGAN
CTGGTTTCNANNANGTCNNNTCNNANCCNCCCGAANNCNNNNTGCANNTNCCTTCATGCCTCCAGATGGGTCNTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14445G11BBF1
Sequence
CCTTCCCACTGCACATTGCACAGTGGAGTGGTCCCCACCCCTTCAAGACGCCAGTGGTATGGCCCTCCCAGANCCCAGAG
CGCTCGCACCCCACCACCCCCACGTCCGCGTGCGCGCAGCTTCTCCTAGTCCCTTCCCGACCGGGAGGTAATAAAATAGT
TGGATCT
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251755..7251920 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]


Sequence tag IST14445G11HMR1
Sequence
AAGGTACTAAACNAGGTTAAAGCTCTAAGGGAAAAGCTTAGAGCCTGGCGGTCCTGCATGCTANAACCTTATGGGACCTC
ACCTAGTGAGCACAANNCTGTNTNNTGGTGCNNANNGCCTCCGCCTTCCGGCTGCCATCTCCAGAGCAAGCTGCGCGCCC
CCACCCCGAACCCCTANAGCCCGCGAGAGCCGGTCCTCGCTGGGCACCANCCANGGCCNANGGGTACCANGGATACNGTT
TTCCNGGTCTTCTGTGGGGTGCTCCACTGCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es