Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14914F11
Clone ID IST14914F11
Vector VICTR76
Project tigm

Sequence tag IST14914F11HMF1
Sequence
GGACTTTGGAGGTTCTATGTTTGGCTTAAAAGAGGCAGCCAGAGTCTCTTGGAGACCGTTCAGTGGGTGAAGGCGCTTGC
TGCCAGGCCTGATGGCTGAGTTCAGTTCTCGGACGCCACACAACGGAAACGCAGAACTGATTCTCCCACCGAGTCCTCTG
ACCACCCACATAGGTGCTGTGGAGTGTTGCCCTGCTAATTAAGGTCAAAGTCTACCATTGTCCAGATAGCCTTCTGAGCT
CTCACAAAATGGTGGACTCTCTTTACCAGCAGGGCTTCTCCTTCTCTGANNNNNNCCGGANAGTTCAACCCCCACCCCGG
TCN
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135168790..135169111 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST14914F11HMR1
Sequence
GTCCTGGCAGTAAATAAAATCTGACCGCCCTGGGACACGTTTCCTTTCTCTCCCAGGGCCCAGTTCTTGCTCTTTGCTTC
CACTACCCCGGATAGCCTCCAGGGGGCAGCACATCTCCTGCCCTCTACTGCCCAAAGTTCANCAGAAACTCCCATTCCTT
GGAGACCTTAAGCATTTCCAACCTACTTTTCACTACGCTTTCTAAGTGAGCGCTGCTGGGGGCTGAGTANAGACCACACA
GGCAGTAAGTACACTCACTGCCACACTCATAGGATCCANCTTTCCTGGATTATCCATGTTANCAAACTGCAGCCCGTGGG
CTTGATTCTGTGTGGCANCNAGTCNNNGGCCNNNCGCTGACAGACTTACTANGAGTTGTGGATATGGACCANCNNGCNAA
GCACTGTTGCNNANGTCTNNNGATCTCAGTTNNANTCCCCAGCNNCNTCGTAAAAGCTGAATGGAACNNNGCCNGNAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14914F11BBF1
Sequence
NGNNNNNGGAGGTTCTANGTNNGGCTTAGNAAANGCNNCCCNAGTCNNTTGGANACCNTTCANTGGGTGAANGCNCTTGC
TGCCNCGNNNNNNGGCTGANTTCAATTCTNNGACGCCCCNCNNCGGAAACACAGANNTGATTCTCCCNCCNAGTCCTCTG
ACCNNNCNNATANGTGCTGTGGANTGTTNCCNNGCNNATTANNGTNAAANTCTACNNNTGTCCNNATNNCCNTNTGAGCT
CTCACANANTGGTGGACTCTCTTTACCNNCNNGGCTTCTCCNTNTCTGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es