Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9021-NR
Clone ID PST9021-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9021-NR
Sequence
GAATCTAACCTCTTCCCCACATCTGATGTGGCCCTGTGCTGACAAGGGTCCGAAGAAGGTGTTGCATATCTATAGT
Sequence Type genomic DNA
Unitrap ID UNI15132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77381614..77381688 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es