Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14048A4
Clone ID IST14048A4
Vector VICTR74
Project tigm

Sequence tag IST14048A4BBF1
Sequence
GTTTTTCGAGACAGGGTTTCTCTGTATACCCCTGGCTGTCCTGGAACTCAG
Sequence Type genomic DNA
Unitrap ID UNI28017 UNI34911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 79509538..79509587 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55989108..55989157 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050077 (Zbtb11) zinc finger and BTB domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:2443876]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3559115..3559164 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86537480..86537529 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96515938..96515987 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032413 (Rasa2) NM_053268 RAS p21 protein activator 2 Gene [Source:MGI (curated);Acc:Rasa2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57501319..57501368 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 105577448..105577497 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30256689..30256738 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16480366..16480415 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60899669..60899718 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41145722..41145771 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 171889193..171889242 50
NO GENE  

 
Come back to gene ENSMUSG00000032413


For any suggestions or comments, please send an email to unitrap@crg.es