Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12365-NR
Clone ID PST12365-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12365-NR
Sequence
GGTGTAAGGTGGCTTTGAATTTGGACTGACTCGAAATGTGAGAAAACGACCCGGAGAAAAATGATCTCAATCTGCCTTCC
ATTCGCGACCTTCTCACTGGCGTTGGAATACTTTGTTTTAATCATAAACTGAAACTTTGAAGTTTTCCATAACTGAACAA
ACGGGAGGGCTTCCCATGGCTGCAGTGGAATTAGTTTGTAGCACACAGTCAAACAAGGGAGTTTTAAATAGAGGCAATAG
CAACTGCATTTGTTTCTTTTAGGATATTT
Sequence Type genomic DNA
Unitrap ID UNI15133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9094274..9094542 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es